Complemented palindrome small RNAs first discovered from SARS coronavirus
By
Chang Liu,
Ze Chen,
Wenyuan Shen,
Deshui Yu,
Siyu Li,
Yue Hu,
Haishuo Ji,
Wenjun Bu,
Qingsong Wang,
Gao Shan
Posted 07 Sep 2017
bioRxiv DOI: 10.1101/185876
In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.
Download data
- Downloaded 19,578 times
- Download rankings, all-time:
- Site-wide: 329
- In genomics: 14
- Year to date:
- Site-wide: 46,573
- Since beginning of last month:
- Site-wide: 46,573
Altmetric data
Downloads over time
Distribution of downloads per paper, site-wide
PanLingua
News
- 27 Nov 2020: The website and API now include results pulled from medRxiv as well as bioRxiv.
- 18 Dec 2019: We're pleased to announce PanLingua, a new tool that enables you to search for machine-translated bioRxiv preprints using more than 100 different languages.
- 21 May 2019: PLOS Biology has published a community page about Rxivist.org and its design.
- 10 May 2019: The paper analyzing the Rxivist dataset has been published at eLife.
- 1 Mar 2019: We now have summary statistics about bioRxiv downloads and submissions.
- 8 Feb 2019: Data from Altmetric is now available on the Rxivist details page for every preprint. Look for the "donut" under the download metrics.
- 30 Jan 2019: preLights has featured the Rxivist preprint and written about our findings.
- 22 Jan 2019: Nature just published an article about Rxivist and our data.
- 13 Jan 2019: The Rxivist preprint is live!